circad | circRNAs associated with diseases

hsa_circ_0003575
Gene	CHMP5	Organism	Human
Genome Locus	chr9:33271149-33278223:+	Build	hg19
Disease	Atherosclerosis	ICD-10	Atherosclerosis (I70)
DBLink	Link to database	PMID	28946214
Experimental Method
Sample Type	Cell Lines	Comparison	Human umbilical vein endothelial cells (HUVECs) vs induced by oxLD
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CATCCGCTACCTCATCTCGT Reverse GTTGCTACCACCACTCCCATA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, CY, Ma, L, Yu, B (2017). Circular RNA hsa_circ_0003575 regulates oxLDL induced vascular endothelial cells proliferation and angiogenesis. Biomed. Pharmacother., 95:1514-1519.